Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU047
Clone ID RRU047
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU047
Sequence
TTTGCTGCATTTCAACTGCAGAACAGTGGTGATTGGAAATGGAACTGCCTGCCGGGAAACTGAAGCCTACTTTGCTGACC
TGATAATGAAAAATTACTTTGCACCACTGGATGTCGTTTACTGCATCGTCAGTGAAGCAGGGGCCTCCATCTACAGTGTC
AGCCCCGAAGCGAACAAGGAGATGCCAGGACTGGACCCTAACTTGAGAAGTGCAGTTTCCATAGCAAGGCGTGTTCAAGA
TCCATTAGCTGAGCTAGTGAAATATGACCCGAAGCACATTGGAGTTGGAATGTAT
Sequence Type mRNA
Unitrap ID UNI3421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 86450429..86497959 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024135 (Srbd1) S1 RNA binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1925836]

 
Come back to gene ENSMUSG00000024135


For any suggestions or comments, please send an email to unitrap@crg.es