Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST144171
Clone ID OST144171
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST144171
Sequence
ACTGAGGTCTCTCCTGTTCTTGCCCATTTGACTGAAGAAGGACAACGGGGTCAAGGTTTGAGGACTGACAGATTCTAGAC
CCAGGCTTCCTCAGCCCCCAGAAAGCCACCAGACCTCACATGGAACCAAAGGCCCCATGCCCAGCCGCCGTCCCCTCAGA
GGAGAGGAAGTTCCGTGTTCTTGTGGNCGTCACTGGCAGCGTGGCCNGCTCTGAAGCTGCCTCTNNTNNTATCTANGGTG
NTGGACGTTCCTGGGCTGGAAGTCACAG
Sequence Type mRNA
Unitrap ID UNI22626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57282707..57285291 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es