Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU200
Clone ID RRU200
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU200
Sequence
GCTTGCAAGCTCCTTTTGTAACTCAGCAGTCACGGGAGTTTCTGTGTGATGTGTTCTGCATGACTCTACTGGGAGTTGTG
AGAGGAGGTTAGTCAAGCTCAGAACTCCAAACACGTGTCTTCGCTGGATACTGTGAATTTAGCTCAAGCAAGCTCAGAAC
TTCACACATGGTA
Sequence Type mRNA
Unitrap ID UNI3415

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177493966..177497608 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078864 (OTTMUSG00000016321) predicted gene, OTTMUSG00000016321 Gene [Source:MGI Symbol;Acc:MGI:3652185]

 
Come back to gene ENSMUSG00000078864


For any suggestions or comments, please send an email to unitrap@crg.es