Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU238
Clone ID RRU238
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU238
Sequence
AGATCCGGTGGTAGCTGCGGCAGCGGTGGCGGCGGCGGCGGCAGCGGCCGGGGAGGTTCATAATTAAGGTGCTAAGGAAG
AGAATGTAAGACAGGAAAATAAATATTTTTACTG
Sequence Type mRNA
Unitrap ID UNI1450

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13256593..13265230 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079844 (Mkl2) NM_181860 MKL/myocardin-like 2 Gene [Source:MGI (curated);Acc:Mkl2-004]

 
Come back to gene ENSMUSG00000079844


For any suggestions or comments, please send an email to unitrap@crg.es