Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU351
Clone ID RRU351
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU351
Sequence
TGTGTCAACGGGGATATGGACAAGCCTTTAGAACCAGCCTCTGAGGATGGCTCCGAGTCAGAGGGGAGCGAGTCCAGCA
Sequence Type mRNA
Unitrap ID UNI7364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88155467..88156926 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001415 (Smg5) NM_178246 Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2447364]

 
Come back to gene ENSMUSG00000001415


For any suggestions or comments, please send an email to unitrap@crg.es