Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU352
Clone ID RRU352
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU352
Sequence
GAGGCCGATACTAGCTGGTTGTGAGCTCTTCTAGATGGTTTTTTAGAAAGAGGTGCAAAGAAGACTGCAGAAATTGGTTG
TGAGCTCTTCTAGATGGGTGAAAGTTCACTTAGAAACTTTACGATGGACACAGAGTCCAGTGTTTATAACTTTGAAGGAG
AAGACTATAGAGAAAAACAAAAGATTGCATTCACAGAGTGGATTGAACCACCAAAAAGAGAAAGAAAAGCCAACTATGCT
GTTGATGCATATTTCAGGGAAGCTCTCCGTGTTAGTGAGCCTAAAGCACCCAAGGCACCTCGACCTCCAAAACAACCAAA
TGTTCAGGATTTCCAGTTCTTTCCTCCGCGTTTATTTGAATTACTGGAAAAAGAAATTCTGTATTACAGGAAAACTATTG
GGTATAAGGT
Sequence Type mRNA
Unitrap ID UNI7365

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83233010..83235585 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031715 (Smarca5) NM_053124 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 Gene [Source:MGI (curated);Acc:Smarca5-001]

 
Come back to gene ENSMUSG00000031715


For any suggestions or comments, please send an email to unitrap@crg.es