Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST142631
Clone ID OST142631
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST142631
Sequence
GACTGAGAGCTGTTGCCCAAAGGGAGCAAAGAGGACAGCGGGACTATGTCTTCTACCTGGCCGTGGGCAACTACCGGCTC
AAGGAATATGAAAAGGCTCTAAAGTATGTGCGAGGGCTGTTGCAGACTGAGCCCCAGAACAACCAGGCCAAGGAGCTGGA
ACGCCTGATTGATAAGGCCATGAAGAAAGATGGACTGGTAGGCATGGCCATCGTTGGTGGCATGGCCCTGGGCGTGGCAG
GCCTGGCTGGACTCATTGGACTGGCTGTCTCCAAGTCCAAATCCTGAAGGCAGCCTCACCTGCTCTCTGCCCCGGGACGC
CTAGGAGCCTGGGGGACACTTGGAAGAGGGGCCTGTCCACCCTCACCATCGCCTTCCCTTTTCTCCTGCACCCCTGTAGT
CTACCTCTACAGTCTCCATGACCCCCAGCCTCTTAGCCCCTGCACCTGTCGTTTAACCCTGTCATGCTTTGCAATGAGTG
TAAATAAAATTGGGCCGTGGCTCGGGAAAAAA
Sequence Type mRNA
Unitrap ID UNI16986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137440961..137442104 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019054 (Fis1) NM_025562 Friend virus integration site 1 Gene [Source:MGI (curated);Acc:Fis1-002]

 
Come back to gene ENSMUSG00000019054


For any suggestions or comments, please send an email to unitrap@crg.es