Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST142536
Clone ID OST142536
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST142536
Sequence
AGGTAGGGAGTTCCCCACAACTGGGCTGCATTCAAATGAATGAGGCATAGGGCATTGGGGGAATTCCTAGGACATGATGA
ATTGA
Sequence Type mRNA
Unitrap ID UNI26057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4135657..4135740 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024842 (Cabp4) NM_144532 calcium binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1920910]

 
Come back to gene ENSMUSG00000024842


For any suggestions or comments, please send an email to unitrap@crg.es