Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU368
Clone ID RRU368
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU368
Sequence
TCCAGGCATTGGATCTGTTGCAGCCAAACTGAATTTGAGTCCATCTCAGTTTATAAATGAGGAAAATCTCCCTGTATATC
CTGGTGAGATACTTTCATCAGATTCTGTTAGCCTGGACATTGAGGAAAGTGTTCTGATTGACACATCTCAGAGAGAGAGT
TTACCGTCTGAAAACAAAACAGAAAACTGCAGGGCCCAAAAAAGAACCCGGGTTGAAGAAAATGATGTTACAAATGAGAA
AAAAATCAGAACACATGACAGTGCACAAGATCAAGAGGTCCCAATA
Sequence Type mRNA
Unitrap ID UNI3892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118898079..118898357 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027326 (Casc5) NM_029617 cancer susceptibility candidate 5 Gene [Source:MGI (curated);Acc:Casc5-004]

 
Come back to gene ENSMUSG00000027326


For any suggestions or comments, please send an email to unitrap@crg.es