Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST142442
Clone ID OST142442
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST142442
Sequence
ACTGAGTGAATGGCAGAAGGTAAAGTTGATCTTTGATGGAGTTGACACGGTTGCAGAAATCCTGTTCAACAATGTCACCA
TTGGGAAGACAGACAACATGTTCACTGGATACAGCTTTGACGTCACCAACGTAGTCAAAGACGTGAACTCCTTAAAGCTG
CAGTTCCGGTCAGCAGTGCAGTATGCAGAGTGTCAGAGCAAGGCTCACACTAGCTACCGGGTGCCCCCAGAGTGCCCCCC
GGTGGAGCAGAAGGGTGAATGTCACGTCAACTTCATCCGAAAGGCACAGTGTTCCTTCAGCTGGGACTGGGGCCCTTCCT
TCCCCTCTCAGGGAATCTGGAAAGATGTTAGAATCGAAGCCTATAACATTGCTCATCTGGATTACCTCACGTTTTTGCCA
GTATATGATAACGCTTCTCAG
Sequence Type mRNA
Unitrap ID UNI26060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135173934..135185969 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es