Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST141892
Clone ID OST141892
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST141892
Sequence
GCGCTGCGAAGGGAACCANTCCAGGGCGGGACGAGAGGCTTTTGCAGCCCAGCTGGTTCCGGCTGGGGAAGATGGCAGGT
GGCTGGGGCAGGCGTACCGGGAGCCGCTAGTACACTGGTGCACACAGCAGNTGCAAAAAACTTTCGCCCTGGATGTCAGG
GNGGAAATCATACATNTTTGGGCAGTCAAGATGATGNANNTGGAGGAAGCTGAAGGTNTTCTGAGAGCACTNAAATACAC
TTGTCAGCATCCANCAAACTCTTCAATAAAGAATATGCATTATGATTTGAAAAA
Sequence Type mRNA
Unitrap ID UNI26065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65732050..65732906 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032386 (Trip4) NM_019797 thyroid hormone receptor interactor 4 Gene [Source:MGI (curated);Acc:Trip4-001]

 
Come back to gene ENSMUSG00000032386


For any suggestions or comments, please send an email to unitrap@crg.es