Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS410
Clone ID RRS410
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS410
Sequence
GGGCTTTGACCCACGGTGGATGATGATGCCTTCCTACATGGACCCAGGCATCACCCCGACACGGACGCCCGTGGACTTCT
ACCCCTCAGCCCTGCATCCTTCAGGACTGATGAAGCCCATGATGCCCCAAGAGTCCCTCAGTGGGACTGGCTGTCGCTCT
GAAGATCAAAACTGTGTGCCCTCGCTCCAAGAACGGAAAGTGACCGCCCTCGACCCAG
Sequence Type mRNA
Unitrap ID UNI2309

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32064252..32067708 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]

 
Come back to gene ENSMUSG00000039262


For any suggestions or comments, please send an email to unitrap@crg.es