Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS434
Clone ID RRS434
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS434
Sequence
CCAGGAGATGGTACGGCTGCTGTTTCAGTCAATCCAAAGCTTTGAGAAGAAAGTTCGGGTGATTTATACACAGCTCAGTA
AGACCGTGGTTTGTAAGCAGAAGGCACTGGAGTTGCTGCCCAAGGTAGAAGAGGTAGTGAGCCTTATGAACGAGGACGAG
AGGACCGTGGTCCGGCTTCAGGAGAAGCGGCAGAAGGAACTCTGGAACCTCCTGAAGATCGCCTGT
Sequence Type mRNA
Unitrap ID UNI7385

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23775961..23776361 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031537 (Ikbkb) NM_010546 inhibitor of kappaB kinase beta Gene [Source:MGI (curated);Acc:Ikbkb-001]

 
Come back to gene ENSMUSG00000031537


For any suggestions or comments, please send an email to unitrap@crg.es