Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS530
Clone ID RRS530
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS530
Sequence
GAGTGCCGCCGCCGCAGACACCGTCCAAGAGGGTGCGGCAGAACGCGAGGTCCTACGGCCCAGCCCGGTCCGGTGCGGCC
CGGATCCGTGGCACGGG
Sequence Type mRNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106691313..106691404 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es