Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS553
Clone ID RRS553
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS553
Sequence
CAAGCCGGGCGGTGCAGGCAGCCGGAGCAGCGGCGGCGGGCCGAGCAGCGGGGAGTGGGCAGCGGTGGGAGCCGAGCTTC
TGTCCTTTCTTTCATCCCTCCCTGGCCTTTGTCGCCGCTCTCACGAGTAGCGCCGCCGGGAGAGACCCGGGTAGAGCGCC
AGGCAGACGTTAGTTCCAGCGGCCGGGCGGAGGGCTCCAGAGGGGCCATGTCTCATCAGGGGAAGAAGAGCATCCCGCAC
ATCACC
Sequence Type mRNA
Unitrap ID UNI7395

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37637090..37637335 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029121 (Crmp1) NM_007765 collapsin response mediator protein 1 Gene [Source:MGI Symbol;Acc:MGI:107793]

 
Come back to gene ENSMUSG00000029121


For any suggestions or comments, please send an email to unitrap@crg.es