Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST140466
Clone ID OST140466
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST140466
Sequence
GAACTGAGTGGAACTTCCCGCTCCTGTATGCAAGCATGGTAAACTGGGCCCAGCCCTGGCAACCGGGAACGTGGTGGTGA
TGAAGGTGGCCGANCAGACACCGCTCACCGCGCTCTACGTGGCCAACTTGATCAAGGAGGCAGGCTTTCCCCCTGGCGTG
GTCAATATCGTTCCCGGATTCGGCCCTACCGNCGGGGCTGCCATCGCATCCCATGAGGGTGTGGACAAAGTGGCGTTCAC
AGGCTCCACGGAGGTTGGTCACCTAATCCAGGTGGCCGCCGGGAGCAGCAACCTCAAGAGAGTAACCCTGGAGCTGGGGG
GAAAGAGTCCCAACATCATNATGTNCGACGCTGACATGNACTGGGCTGTGGAGCAGGCCCACTTTGCCCTGTTCTTCAAC
CAGGGCCAGTGCTGCTGCGCAGGCTCCCGGACCTTCGTGCAGGAGAATGTGTATGACGAATTCNNGGAACGCAGCGTGGC
TCGG
Sequence Type mRNA
Unitrap ID UNI26068

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122022742..122026035 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029455 (Aldh2) NM_009656 aldehyde dehydrogenase 2, mitochondrial Gene [Source:MGI (curated);Acc:Aldh2-001]

 
Come back to gene ENSMUSG00000029455


For any suggestions or comments, please send an email to unitrap@crg.es