Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST140449
Clone ID OST140449
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST140449
Sequence
AGCCAAGGGGGTAACTTGTCTTCNGNATTACTGTTNGATGCCTGACCCACACAGTGAAGAGGGAGCCCAGGACTATGTAT
NACTNGTTCAAGCACCANATGCTGTGTGACATGAACAGAGTGCTGGAGCTGCNTCTGATTCTGCGGCAGCCATCACCACT
GTGGCTGTCTTTCACAGTGNAGGAACTGCACATCTACCAACNGGGACCAAAGAGCCCCTCCTTGGCGTTCCCCAAGTGGC
TTTCCCACCCAGTGTCCAATGAGCAGCCTGCTCCCCGCCTTGAGGGTCTCCCANATCCCAGCAGAGTGTCCTCTGAGGTG
CAGCAGATGTGGGCACTGACAGAGATGATTCGGGCTAGTCACACTTCCACGAGGATCGGCCGCTTCNACGTGGATGGCTG
NTATGATCTGAATTTACTCTTCCTACACATGA
Sequence Type mRNA
Unitrap ID UNI26069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108195747..108197440 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]

 
Come back to gene ENSMUSG00000032606


For any suggestions or comments, please send an email to unitrap@crg.es