Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST140291
Clone ID OST140291
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST140291
Sequence
TGAAGTGAGTGATTCAGAATAATTCAAGCTTGTTAGAGGGCTTTAAAAAAAAGTTGATTCGGTGCATGAAAGCAAGTTAA
CTACTGCTGCTCACCGTTGANAGACTTACAGGTGCTTGCCTGAACTGCAATAAAGGACTCATATTATTGAGCAGGAAAAA
AAAAA
Sequence Type mRNA
Unitrap ID UNI15377

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44415208..44415367 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032097 (Ddx6) NM_007841 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]

 
Come back to gene ENSMUSG00000032097


For any suggestions or comments, please send an email to unitrap@crg.es