Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS612
Clone ID RRS612
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS612
Sequence
CACAACCACCACCACAACAACCACCACCACCACCTAGCTATAGCCCTGCTCGGAACCCTCCGGGAGCCAGCAGCTACAAC
AAAAACAGCAACATCCCTGGCTCCAGCGCCAATACCAGCACCCCTACAGTGAGCAGCTACACCCCTCCA
Sequence Type mRNA
Unitrap ID UNI7405

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26509577..26509725 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040725 (Hnrnpul1) NM_178089 heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

 
Come back to gene ENSMUSG00000040725


For any suggestions or comments, please send an email to unitrap@crg.es