Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST140094
Clone ID OST140094
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST140094
Sequence
TGGGCTGCATGGAGCCCCAGAGGTGCACACTGCTTGTCAGCCAGTTCCGCTCCTGTCAGGACAATGTATTAAACATCATT
AATCAGATCATGGAGGAGTGTATCCCTCAGGACCGTGCCCCTCGGGATTAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26072

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34578720..34585879 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037224 (Zfyve28) NM_001015039 zinc finger, FYVE domain containing 28 Gene [Source:MGI (curated);Acc:Zfyve28-001]

 
Come back to gene ENSMUSG00000037224


For any suggestions or comments, please send an email to unitrap@crg.es