Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST139618
Clone ID OST139618
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST139618
Sequence
TGAGGATGTGTTGCCCATGATGATGTGCATGTGAACTTCACTCGAGAAGAATGGGCTTTGCTGAATCCTTCACAAAAGAG
CCTCTACAAAGATGTGATGCTGGAGACCTATAGGAACCTCAATGCTATAGGCTACAATTGGGAAGACAATAATATTGAAG
AACAGTGTCAAAGTTCCAGAAGAAATGGAAGGCATGAAAGAAGACTTATTGGAGAGAAACCCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI2332

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98229792..98231322 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079490 (AC163298.4)  

 
Come back to gene ENSMUSG00000079490


For any suggestions or comments, please send an email to unitrap@crg.es