Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS736
Clone ID RRS736
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS736
Sequence
GAGTCAATCTCCCGCCTCAGGACCGACGTGATGGGCATCCTGGATGGTTCCCTGGGAAACATTGATGACCTGGCACAGCA
GTATGCAGATTATTACAATACCTGCTTTTCTGACGTGTGTGAGCGGATGGAGGAGCTCCGGAAACGGCGCGTTTCCCAGG
ACCTGGATGT
Sequence Type mRNA
Unitrap ID UNI7414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8570162..8605563 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015305 (Sash1) NM_175155 SAM and SH3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917347]

 
Come back to gene ENSMUSG00000015305


For any suggestions or comments, please send an email to unitrap@crg.es