Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST139510
Clone ID OST139510
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST139510
Sequence
GAGACTGAGTTCTCCTCTGCTTGCTGTTGGCGCTCTTTGCCTCCGGCCTCATCCACCGAGTTTGTGTCACCACTTGCTTC
ATCTTCTCCATGGTTGGTCTGTACTACATCAACAAGATATCGTCCACTCTGTACCAGGCAACAGCTCCAGTTCTCACACC
GGCCAAAATCACTGGCAAGGGCAAGAAGAGAAACTAACTGTGAATGAGTAATAAAGTTGTGTCTTTGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13194

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89052994..89053645 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042747 (Krtcap2) NP_079603 keratinocyte associated protein 2 Gene [Source:MGI (curated);Acc:Krtcap2-001]

 
Come back to gene ENSMUSG00000042747


For any suggestions or comments, please send an email to unitrap@crg.es