Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS740
Clone ID RRS740
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS740
Sequence
GACCAGCAACCATACTCAGGCTCGGGCCGCAGTGTACTGTCACTGGAGTCAGGTGCTGGGGGCTGGTTTGACTGGATGGT
TCCAACTCTCCTCCTGTGGCTGGTAAATGGTGTGATTGTCTTGAGCGTCTTTGTGAAGCTGTTGGTCCACGGGGAGCCGG
TGATTCGCCCACACTCACGCCCCTCAGTCACCTTCTGGAGACACCGGAAGCAGGCAGACCTAGACCTCGCCAAA
Sequence Type mRNA
Unitrap ID UNI7417

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82009288..82009977 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es