Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS702
Clone ID RRS702
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS702
Sequence
GCAGACACAGACATGACAACCCAGCTTATTTCTTCCAACTTGGAGCTCCACTCTCTGACCACTGGCCGCCTCCCGAGAGT
TGTTACAGCTAATCGGATGCTGAAGCAGATGCTCTTCAGGTATCAAGGTTACATTGGTGCAGCCCTAGTTTTGGGGGGAG
TAGATGTTACTGGACCTCATCTCTACAGCATCTATCCTCATGGATCAACTGATAAATTGCCTTATGTCACCATGGGTTCT
GGCTCCTTGGCAGCAATGGCTGTGTTTGAAGATAAGTTTAGGCCAGATATGG
Sequence Type mRNA
Unitrap ID UNI3326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38468954..38495711 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026750 (Psmb7) NM_011187 proteasome (prosome, macropain) subunit, beta type 7 Gene [Source:MGI (curated);Acc:Psmb7-001]

 
Come back to gene ENSMUSG00000026750


For any suggestions or comments, please send an email to unitrap@crg.es