Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST138884
Clone ID OST138884
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST138884
Sequence
ACTGAGGCTGGTCGGCTACTCTGGGACAGGAGCTGTACTCTCAGCTGGTTTATCTCACTCCCACCCCGTTCTTCCACACT
TTTGCTGGAGATGACTGTCAAGTAGGACTGAACTTTGCGGATGAGAGTGAAGCCCAGGCCTTCCGGGCCTTGGTGCAGGA
GAAGATACAAAAAAGGAATCAGAGGCAAAGCGGAGAAA
Sequence Type mRNA
Unitrap ID UNI26089

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7666162..7666470 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031165 (Was) NM_009515 Wiskott-Aldrich syndrome homolog (human) Gene [Source:MGI (curated);Acc:Was-001]

 
Come back to gene ENSMUSG00000031165


For any suggestions or comments, please send an email to unitrap@crg.es