Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST138772
Clone ID OST138772
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST138772
Sequence
TGAGGAAGAGGAAGGCATCCCTGGNGTGGTTTCTTTACTGTACTTCCATCAGAAGAGTGAGAGATGGAACCTGAAGAAGA
AAGGATTCGGTACAGCCAGAGATTGCGTGGTACCATGCGTCGTCGCTATGAAGATGATGGCATTTCAGATGATGAAATTG
AAGGGAAAAGAACTTTTGACTTGGAAGAGAAGCTCCAAACCAACAAATATAATGCCAATTTTGTTNNTTTTATGGNGGGA
AAAGATTTTAATGTAGAGTATATCCAGCGGGGTGGCTTGAGAGACCCTCTCATTTTCCAAGAATTCTGATGGACTTGGAA
TAAAGATGCCGGATCCCGACTTCCA
Sequence Type mRNA
Unitrap ID UNI9872

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4361566..4394894 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es