Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST138691
Clone ID OST138691
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST138691
Sequence
ACTGAGGCAAAGTGCAAACAGCGGTGCAGATGTTACATCAGGCTCCTATGTAAGGAAACCACTGTGATCATTTGTCATGG
CGNATGGNTTGCCAAGAAGGAACACAGTACAAACCATTTTGAAGGGCAGCTGTTATAAAGTACATGACCCNTGAGACNNN
GCGTGACTCACTNAGACNAGNCAACACNNACTTGACAGANNANNAGGCTGNCATNNTNGGCAAGAATTCANTTTTTNGAT
AAGGNGGGTGAATCTCTACAGCGACGCCTTACNCANCCAAGGAAACGCCACNTTNNTTCAATAGCAANAACCTGGCNCTC
NGGAAAAGCATGTNTGGAAGCAACTCTCCTA
Sequence Type mRNA
Unitrap ID UNI26090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 104083941..104084077 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029320 (1700016H13Rik) RIKEN cDNA 1700016H13 gene Gene [Source:MGI Symbol;Acc:MGI:1921468]

 
Come back to gene ENSMUSG00000029320


For any suggestions or comments, please send an email to unitrap@crg.es