Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST138659
Clone ID OST138659
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST138659
Sequence
TGTTCCGGATGAAGAGGTGGCCTTGGTCCAGCTCCTGTTGCCCACAGGGTCTGCTTACAACTGTGNGAGCCAGCTTGGTG
AGCTGGGCCTCGTGGAGTTCCAAAACAAGNTCTATTCAGGCACCGGCTACAAAGCTCAGCCCCTTCACCTTCACTGTGGA
CAGAGACTAGCTACCCACTGCAATCCCTGCTTCTCCGAA
Sequence Type mRNA
Unitrap ID UNI20162

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3896085..3904691 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001750 (Tcirg1) NP_001129563 T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3 Gene [Source:MGI Symbol;Acc:MGI:1350931]

 
Come back to gene ENSMUSG00000001750


For any suggestions or comments, please send an email to unitrap@crg.es