Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS789
Clone ID RRS789
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS789
Sequence
AGACGGAAATTCAGGAAGCCAAAGCTCCCAGTCCCTCCATAAACCGGCAAACCAGCATTGAGACGGACCGAGTGACTAAG
GAGTTCATAGACTTTCTCAAGACCTTCCACAAGACAGGCCAAGAAGTCTATAAACAGACGAAGATGTTTTTGGAAGTCAA
TGCCTTATAAAAGGGTCCAAGGG
Sequence Type mRNA
Unitrap ID UNI7437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130673819..130673988 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025340 (Rabgef1) NM_019983 RAB guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rabgef1-001]

 
Come back to gene ENSMUSG00000025340


For any suggestions or comments, please send an email to unitrap@crg.es