Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST138164
Clone ID OST138164
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST138164
Sequence
GACTGAGGTCCTCCTTGTGGTTCATTTCTGGGCACCATGGGCTCCACAGTGTGTACAGATGAACGATGTCATGGCAGAGT
TAGCTAAAGAACACCCTCATGTTTCATTTGTGAAGCTGGAAGCCGAAGCTGTTCCTGAAGTATCTGAAAAANATGAAATT
AGCTCTGGCCCCACCTTCCTGTTCTTCAAGAATTCTCNAANTGNCNACCGGCTAGATGGNGCACATGNTTTTTAGGNGAG
GGGNAAAGTCCAGCGACACGNGTCTNGCGGAGCCTTTCCTNCTAGTACTAATGAACATCTTANCCCNGACCTCAGCCTTC
GCCTGAAAAAGCTGACTCACGCTGCCCCCTGCTTGCTGTTCATGAAGGGAACACCTC
Sequence Type mRNA
Unitrap ID UNI3481

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 144636660..144645282 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031068 (Glrx3) NM_023140 glutaredoxin 3 Gene [Source:MGI Symbol;Acc:MGI:1353653]

 
Come back to gene ENSMUSG00000031068


For any suggestions or comments, please send an email to unitrap@crg.es