Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS858
Clone ID RRS858
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS858
Sequence
CTTCCACTGACTGAGGAGAACAAGCACTGTGGCACAGCTGTTGTTCAGTTCTGGCACCTGTCCAAGATGCATCTTAAGAT
TCTGTGGTGTGGATCTTCCCGCACCTTACAAACACCCATCCAAGGAGTTGCTCAATGAGCTACAAAAATTTCTAGAACCG
GAAAAACCTGAATTAATTTTAGAAGCTCCAAACCCACCATTGAAGAAAATTCGTCTACATGAAGATGGGATTGATAATTT
GAGTGAAGATGGAAAGGAGGGAGTCTCTGTTACTGAAGATGAAAGCATGGCTGAGAAGCCTTCAAAGCTGAGAGTGTGCA
ATGTTTGCTTAGGAATTCTTCAGGAATTCTGTGAGAAGGGGTTTATTACGAAGGTGTGCCAAAAGGTTGAAGCCTCTGGG
TTTGAATTCACCAGCGTGGTTTTATCTGTCTCCTTTCCACCGCAGCTGTCTGTAAGAG
Sequence Type mRNA
Unitrap ID UNI7447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23567292..23573322 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020280 (Pus10) NM_001033654 pseudouridylate synthase 10 Gene [Source:MGI (curated);Acc:Pus10-004]

 
Come back to gene ENSMUSG00000020280


For any suggestions or comments, please send an email to unitrap@crg.es