Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST137727
Clone ID OST137727
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST137727
Sequence
ACTGAGATGGAAATCCTATGACAGACAGTTTGGGTGATATCTGCAGGAAAGATCTTTAAACATTACAGAAGACAATACAC
GCTAATGCATTTGAGAAAACGATATAAATTGGGGGTAGGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI12755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108546642..108547327 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es