Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST137704
Clone ID OST137704
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST137704
Sequence
ACTGGTAGAGCCGAAGAATATGAATAGTTTCTCAAGAAAAGTACATTACTTTTGGCACAAGAAGCAGAATAACTGTGAAT
TGTTATCACGTGGAATTTTTCAGTAAAAATCACTGAAAA
Sequence Type mRNA
Unitrap ID UNI19789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74546530..74546648 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033364 (Usp37) NM_176972 ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]

 
Come back to gene ENSMUSG00000033364


For any suggestions or comments, please send an email to unitrap@crg.es