Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0324
Clone ID CJ0324
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0324
Sequence
GACCAAGGACATCGAGGACGTGTTTTACAAATACGGCGCCATCCGCGACATCGACCTGAAGAACCGCCGCGGGGGACCGC
CCTTCGCCTTCGTTGAGTTCGAGGACCCGCGAGACGCGGAAGATGCGGTGTACGGTCGCGACGGCTACGACTACGACGGC
TACCGGCTGCGGGTAGAGTTTCCCCGAAGCGGCCGCGGGACCGGCCGAGGCGGCGGCGGGGGTGGAGGCGGCGGCGCCCC
GAGAGGCCGCTATGGCCCGCCGTCCAGGCGGTCCGAGAACAGAGTGGTTGTCTCTGGACTGCCTCCGAGTGGAAGCTGGC
AGGACTTAAAGGATCACATGCGTGAGGCAGGTGATGTATGTTACGCTGATGTTTACCGAGATGGCACTGGTGTCGTGGAG
TTTGTACGGAAAGAAGATATGACGTATGCAGTTCGAAAACTGGATAACACTAAGTTTAGATCTCACGAG
Sequence Type mRNA
Unitrap ID UNI752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87861959..87862717 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018379 (Sfrs1) NM_173374 splicing factor, arginine/serine-rich 1 (ASF/SF2) Gene [Source:MGI (curated);Acc:Sfrs1-001]

 
Come back to gene ENSMUSG00000018379


For any suggestions or comments, please send an email to unitrap@crg.es