Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST137261
Clone ID OST137261
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST137261
Sequence
ACTGAGGTGGGGTCTTTATCAGCCTGGGCAAAAAGCACAAGAAGCACAAGGCGGAATGGCGCTCGTCCTACGAAGATTAT
ACAGACACGCCACTGGAGAAGCCTCTGAAGCTGGTGCTCAAGGTGGGAGGAAGTGAAGTGACAGAGCTCTCAGGATCTGG
CCACGACTCCAGCTACTACGACGATCGCTCAGACCACGAACGGGAGAGACACAGAGAAAAGAATA
Sequence Type mRNA
Unitrap ID UNI26106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 74075331..74076029 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057649 (Brd9) NM_001024508 bromodomain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2145317]

 
Come back to gene ENSMUSG00000057649


For any suggestions or comments, please send an email to unitrap@crg.es