Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST137230
Clone ID OST137230
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST137230
Sequence
GCCTGACCTACACGATGCCCGANCTCAGCCGACTCACAGNATGNATNGATCTGATATCTGATGACTAACAGCTCACATTA
CTGGATGGCCTTCATCTACATTACTAATAACACTCTCCTGGGCAGAGAANATGTAGACCTTGGACTCGCAGGANACCATC
AGCAGCTGATACTGTACAGCTTTGGCAAGACCTTCTATGTCAGTTATCACCTGATTCCATTTCATTGGCATACCCTGTGC
TTGGTATGGGATGGTGNGAAGGGCAGATTAGAGCTCTTCCGGAACAAAGAAAGGATACTTGCAATAATGGATCAGCCACA
CAGACTGTCTCCTAATGGGACTTTGGTCTTGGGACACTTTCCCAGGAATGGAGGAGGGTCAGATTAAAACTGNGATACCT
CGCTTTAAAAAA
Sequence Type mRNA
Unitrap ID UNI26107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 54147490..54147897 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053852 (Gpr112) NP_001104260 G protein-coupled receptor 112 Gene [Source:MGI (curated);Acc:Gpr112-003]

 
Come back to gene ENSMUSG00000053852


For any suggestions or comments, please send an email to unitrap@crg.es