Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT060
Clone ID RRT060
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT060
Sequence
CAGTGGCCACGACCAGTCAGGAGGGGCCCCAGCTCTCCCAGGAATCCCAGCGTGTGCCTGCACCTGAGGTGGCGTCAGGA
CCCGATCCTGAGGAGGAAATTCGGATGGATCTGAGCCCTGACCTCATATCAGCCTGCTTGGCCCTGGAGAAATACCTGGA
GAACCCCAATGCCCTCACAGAGCGAGAACT
Sequence Type mRNA
Unitrap ID UNI7466

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21580146..21584247 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es