Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST136472
Clone ID OST136472
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST136472
Sequence
ACTGAGCCACACGTACCTCTTTATGGTACAAGCTAGAGGTATCATGCTGAGAGAGAATGTGAAAACAATTGGACACATGA
TCAGGCTGTATACCAATAAAAACACTACGCTCAACGGAACAGATTATCCTGANGGCAATANTACAAGTGACTATCTT
Sequence Type mRNA
Unitrap ID UNI5973

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 20878609..20886581 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056124 (B4galt6) NM_019737 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1928380]

 
Come back to gene ENSMUSG00000056124


For any suggestions or comments, please send an email to unitrap@crg.es