Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR793
Clone ID RRR793
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR793
Sequence
CCCAGCCTGAGCCAGAGAAGAGTTCGGATTAAGTGTTAAGAGAAAGCGGGTCCAGGCAAAGCAGTTGGACAAGCAATCCC
GCAGAGCGCATCAGGGTGCATCTCTAGACAGTTGGGGATCGCCAGGTCTGAGTGTGCACCGGGTCTGCTAAGTTTTGCCT
TCACCTAGCGTTTCGGATCCCGCCTGGATGGAGTCCCTCTTGGATTTCCATTGGCTCCTGTGAGTGCTTGGGTGTCGGGA
GCTTGTTTTTTTGGCGAAGGGAACCAACTTTTGAAGTTCGCCCAGGAGACCGCGTTCCAGCCTCAGTGCCTAGGCAGCGG
GACCCGGCGGAGGCGCGACCGCGGCGGGAGTCACCAT
Sequence Type mRNA
Unitrap ID UNI3110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70055154..70055509 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032220 (Myo1e) NM_181072 myosin IE Gene [Source:MGI Symbol;Acc:MGI:106621]

 
Come back to gene ENSMUSG00000032220


For any suggestions or comments, please send an email to unitrap@crg.es