Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR801
Clone ID RRR801
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR801
Sequence
GCTTTCCCAGGCGGCTGCCGAAGATGGCGGAGGGGCAGGTTCTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTG
GCGGCCATTGTGGCCAAGCAGGTACTTGTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGAAA
CTTCTACAGAAGA
Sequence Type mRNA
Unitrap ID UNI7477

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52382585..52384106 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003426 (Rpl13a) NM_009438 ribosomal protein L13a Gene [Source:MGI (curated);Acc:Rpl13a-001]

 
Come back to gene ENSMUSG00000003426


For any suggestions or comments, please send an email to unitrap@crg.es