Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST135991
Clone ID OST135991
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST135991
Sequence
GAACTGAGGTTTTATGGGAGCTAGAACCTTACGCCTCGTAAGTCACTTTGAGAAGTCCATGAAGGCAGAAGCTGAAGATG
ACGATGATTTATATATAGTAGACAACAATGGAGAGGAACAGCTGTTTGACTGTAGTGGCCAAGATTTTGAAAATAAGCTT
CGAGTTCCTCTTTTTGAAATACTGAAGTACCCTTACTTGCTTCA
Sequence Type mRNA
Unitrap ID UNI22528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28985698..28985895 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043535 (Setx) NP_932150 senataxin Gene [Source:MGI (curated);Acc:Setx-001]

 
Come back to gene ENSMUSG00000043535


For any suggestions or comments, please send an email to unitrap@crg.es