Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR815
Clone ID RRR815
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR815
Sequence
TCGCCGCCCGGGATCCTCAGGCCGAGCAGTAGGCCGGCCGGCTGCCCACCACTGCCCCGGGACGGAAAGCGGAGCCGCGG
AACCGGTGGTCCGGCGGGCGTGCCGA
Sequence Type mRNA
Unitrap ID UNI7481

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181255294..181255399 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000826 (Dnajc5) NM_016775 DnaJ (Hsp40) homolog, subfamily C, member 5 Gene [Source:MGI (curated);Acc:Dnajc5-001]

 
Come back to gene ENSMUSG00000000826


For any suggestions or comments, please send an email to unitrap@crg.es