Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR002
Clone ID RRR002
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR002
Sequence
GGCCTCCATTGACGCCACCTACGCCAAGCAGTATGAGGAGTTCTACATAGGATTGGAAGGCAGCTTTGGCTCAAAGCACG
TCTCTCCCCGGACTCTCACTTCCTGCTTCCTCAGCTGTGTGGTCTGTGTGGAAGGCATTGTTACTAAATGCTCTCTGGTT
CGCCCCAAAGTCGTTCGCAGTGTTCACTACTGTCCTGCTACTAAGAAGACCATAGAGCGACGCTACTCTGACCTCACCAC
CCTAGTGGCTTTCCCATCCAGTTCTGTTTATCCCACAAAGGATGAGGAGAACAACCCCCTGGAGACAGAGTATGGCCTGT
CTGTCTACAAGGACCACCAGACCATCACCATCCAGGAGATGCCAGAGAAGGCCCCTGCTGGTCAGCTCCCTCGCTCCGTG
GACGTCATTCTAGACGATGACCTGGTGGATAAAGTGAAGCCTGGTGACAGAATACAGGTGGTGGGGACCTACCGCTGCCT
TCCAGGGAAGAAGGGCTGCTACACCTCGGGGACCTTCAGGACCGTCCTGATTGCCTGTAATGTGAAGCAGATGAGTAAGG
ATATTCAGCCTGCATTCTCTGCGGACGATATAGCCAAGATCAAGAAGTTCAGCAAAACTCGTTCCA
Sequence Type mRNA
Unitrap ID UNI7483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 20804482..20807472 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041859 (Mcm3) NM_008563 minichromosome maintenance deficient 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:101845]

 
Come back to gene ENSMUSG00000041859


For any suggestions or comments, please send an email to unitrap@crg.es