Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR004
Clone ID RRR004
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR004
Sequence
ACAAAAGCGTGGCCCTGGCTTTAAGTATGCCTCCAACCTGCCTGGCTCCTTGCTCAAGGAGCAGAAGATGAACCGGGACA
ACAAGGAAGGGCAAGAGCCTGCCAAGCGGAGAAGTGAGTGTGAAGAGGCTCCCCGTCGGAGGTCAGACGAGCACCCCAAA
AAGGTGCCTGCAGATGGCATCCTCCGCCGAAAGTCTGATGATGTGCACCTGAGGAGGAAGCGGAAATACGAGAAGCCCCA
AGAGCTGAGTGGACGCAAGCGAGCCTCGTCGCTTCAAACGTCCCCCGGTTCCTCCTCTCACCTCTCGCCGAGGCCCCCTC
TAGGCAGCAGTCTCAGCCCTTGGTGGAGATCCAGTCTCACTTACTTCCAGCAGCAGCTAAAACCTGGCAAAGAAGATAAG
CTTTTCAGGAAAA
Sequence Type mRNA
Unitrap ID UNI7485

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123331646..123332233 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es