Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR005
Clone ID RRR005
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR005
Sequence
TAACAGTGAATACCCCGCAGAAAATAAGCAGGCTTTAATGAAGGACCTCCTGACACCACTGATGGAGAGGTTCAAGGTTC
TGTTGGAAAAGCTGATGATGGCGCAGGATGAAGAGAGACAAGCATCTCTTGCAGACAGTCTCAACCACGCAGTGGGATTC
GCCAGTCGAACCAGCAAGGCCTTCAGCAACAAGCAGACTGTGAAACAGTGCGGCTGCTCCCAGGTCTACCTGGACTGCTT
ACAGACCTTCCTGCCAGCCCTCAGCTGCCCCTTGCAAAAGGACGTCCTCCGAAGTGGTGTGCGGACCTTCCTCCATCGGA
TGATCATCTGCCTCGAGGAGGAGGTGCTCCCGTTCATCCCGTCGGCCTCGGAGCACATGCTCAAGGACTGTGAGGCGAAA
GACCTCCAGGAGTTCATCCCACTCATCAACCAGATCACGGCCAAGTTCA
Sequence Type mRNA
Unitrap ID UNI14

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 121040087..121041566 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034667 (Xpot) NP_001074525 exportin, tRNA (nuclear export receptor for tRNAs) Gene [Source:MGI Symbol;Acc:MGI:1920442]

 
Come back to gene ENSMUSG00000034667


For any suggestions or comments, please send an email to unitrap@crg.es