Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST135249
Clone ID OST135249
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST135249
Sequence
CACAACAAGGAGTGTCTGATCAACATTTCCAAATACAAGTTTTCTCTGGTCATCAGTGGGCTCACCACCATCCTAAAGAA
TGTTAACAATATGAGGATATTTGGAGAAGCTGCTGAAAAAAATTTGTATCTCTCTCAGTTGATCATATTGGATACACTGG
AAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAGACAATGCTGGTCAAACAATTACTACCAGAAATC
TGCCATTTTCTTCACACCTGCCGTGAAGGAAACCAACATGCAGCCGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTC
TCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACAAGGTTACAGGAGTTGACTGTCTGTTCAGAAGATA
ATGGNTGATGGTCACGATATANAATTGNTACAGNATATCAATGGGGGATNGNGCAAAANTAAAACGACTTCTGAAGGG
Sequence Type mRNA
Unitrap ID UNI26136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79197728..79209464 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]

 
Come back to gene ENSMUSG00000020716


For any suggestions or comments, please send an email to unitrap@crg.es