Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST135195
Clone ID OST135195
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST135195
Sequence
ACTGAGGAAACCTTAAGAATGGAGTCTAAACCTTCCAGGATTCCAAGAAGAATTTCTGTTCAACCCTCTGGCTCTTTAAG
CACTAGGATGGTGTCTGGAAACAGAGGAACCAGTTTAAATGATTCATATCATTCTAGAGACTCCTCCTTTAGACTGGATT
CTGAATATCAGTCTGCATCAGCATCAGCGTGTGCATCACCATGTCAGCCTGCCTGGTACAGTGAGTCTGAGATACCTCAG
GGAGCGCGGGCACGAGCACAGACCCAGCAGCGGGATCATGACTCAAAGAGACCCAAGCTTTCCTGTACAAACTGTGCATC
TACCTCAGCTGGGAGGAACGGTGGGAGTGGGTTAAATACAGTGTCAGAT
Sequence Type mRNA
Unitrap ID UNI17611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60066973..60067936 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026977 (March7) NM_020575 membrane-associated ring finger (C3HC4) 7 Gene [Source:MGI (curated);Acc:March7-003]

 
Come back to gene ENSMUSG00000026977


For any suggestions or comments, please send an email to unitrap@crg.es