Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST135185
Clone ID OST135185
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST135185
Sequence
GACTGAGTGCCTTCCCGAAGCCTACTGTTCTACGATGATGGGGCAGGCTCATGGGAAGATGGCCGAGGTGCTCTACTGCC
TGTGGAGCCCCCAGAAGGCTGGGAGCTCAAACCCGGGGGTCCAGCAGAGCAGAGGCCCCAGGACCACCTCCGACATGACC
GTGCAGACAGCATCCATGAGACCACCAAGTACTTGAGAGAGACCTGGCCAGAGGACACTGATGACAACGGCACCAGCCCC
AACTTCTCCCACCCCAAGGAGTGGTTCCATGACAGGGATCTGGGCCCCAACACCACCATCAAACTCTCCTAGGCCACTCC
AAGACCCAGGACACAGGACGGACACCCTGGCACCCAGAAGAGGCGTTCTCTTGCTCGATGACCCAGATCCAGCTCATACC
CCTGCCCCCCGGGTCCCTGTAGTAGCTGGGGACGCTCTATGTCCCCAGACACTTGGACTGGTNCCCTGGGCTTGACCACT
CCGTTTCCACCTTTTCCTNCTACCACTATCCGTCCTTCTNCGATAAACCACTCACTGG
Sequence Type mRNA
Unitrap ID UNI21893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91822903..91823591 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027230 (Creb3l1) NM_011957 cAMP responsive element binding protein 3-like 1 Gene [Source:MGI (curated);Acc:Creb3l1-001]

 
Come back to gene ENSMUSG00000027230


For any suggestions or comments, please send an email to unitrap@crg.es