Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR047
Clone ID RRR047
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR047
Sequence
GAAGAACGTGCTGCTGCTGGGTGAAGATGGAGCTGGGAAGACAAGCCTCATAAGAAGAATTCAGGGCATAGAGGAGTACA
AGAAGGGAAGAGGACTGGAGTACCTGTACTTAAATGTGCACGACGAAGACAGGGATGATCAAACAAGATGTAATGTATGG
ATCTTAGATGGAGATCTGTACCACAAAGGGCTACTCAAGTTCTCTCTGGATGCCCTTTCTCTGAGGGACACTCTGGTCAT
GTTGGTTGTTGATATGTCAAAGCCTTGGACTGCTTTGGATTCCTTACAGAAATGGGCAAGTGTGGTGAGAGAACATGTCG
ACAAGCTGAAAATCCCCCCTGAAGAGATGAAGGAAATGGAGCAGAAGTTGATTAGAGACTTCCAAGAGTACGTGGAGCCA
GGAGAAGACTTCCCAGCCTCCCCTCAGCGAAGAACCACTGGTGCGCAGGAGGACAGAGGTGACAGTGTTGTCCTGCCCCT
GGGTGCAGACACACTCACACACAACCTGGGCCTACCAGTGCTCGTAGTCTGTACGA
Sequence Type mRNA
Unitrap ID UNI7496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114598381..114618430 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032435 (Dync1li1) NM_146229 dynein cytoplasmic 1 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:2135610]

 
Come back to gene ENSMUSG00000032435


For any suggestions or comments, please send an email to unitrap@crg.es